View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8772_high_1 (Length: 218)
Name: NF8772_high_1
Description: NF8772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8772_high_1 |
 |  |
|
| [»] chr4 (21 HSPs) |
 |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] scaffold0713 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0388 (1 HSPs) |
 |  |  |
|
| [»] scaffold0230 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0673 (1 HSPs) |
 |  |  |
|
| [»] scaffold0637 (1 HSPs) |
 |  |  |
|
| [»] scaffold0560 (1 HSPs) |
 |  |  |
|
| [»] scaffold0512 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold1095 (1 HSPs) |
 |  |  |
|
| [»] scaffold0278 (1 HSPs) |
 |  |  |
|
| [»] scaffold0056 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold1403 (1 HSPs) |
 |  |  |
|
| [»] scaffold0509 (1 HSPs) |
 |  |  |
|
| [»] scaffold0471 (1 HSPs) |
 |  |  |
|
| [»] scaffold0360 (1 HSPs) |
 |  |  |
|
| [»] scaffold0218 (1 HSPs) |
 |  |  |
|
| [»] scaffold0096 (1 HSPs) |
 |  |  |
|
| [»] scaffold0084 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0022 (2 HSPs) |
 |  |  |
|
| [»] scaffold1496 (1 HSPs) |
 |  |  |
|
| [»] scaffold0532 (1 HSPs) |
 |  |  |
|
| [»] scaffold0317 (1 HSPs) |
 |  |  |
|
| [»] scaffold0113 (2 HSPs) |
 |  |  |
|
| [»] scaffold0042 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 21)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 3771667 - 3771461
Alignment:
| Q |
12 |
atgaaccgtgtactttttactacttcgatagaactgtacacttgcggttttactcatcacttcccctctcatgcaacaccatcacttcaacatcatcatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3771667 |
atgaaccgtgtactttttactacttcgatagaactgtacacttgcggttttactcatcacttcccctctcatgcaacaccatcacttcaacatcatcatc |
3771568 |
T |
 |
| Q |
112 |
atcagaaaatgatgacacttttgaatttgttcgtcctatagaccgcaaattattaagcctaaagaaggaaaaactaagtcatttcagattctactggcac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3771567 |
atcagaaaatgatgacacttttgaatttgttcgtcctatagaccgcaaattattaagcctaaagaaggaaaaactaagtcatttcagattctactggcac |
3771468 |
T |
 |
| Q |
212 |
gacatag |
218 |
Q |
| |
|
|| |||| |
|
|
| T |
3771467 |
gagatag |
3771461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 102 - 218
Target Start/End: Complemental strand, 3755819 - 3755703
Alignment:
| Q |
102 |
catcatcatcatcagaaaatgatgacacttttgaatttgttcgtcctatagaccgcaaattattaagcctaaagaaggaaaaactaagtcatttcagatt |
201 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3755819 |
catcatcatcatcagaaaatggtgacacttttgaatttgttcgtcctatagaccgcaaattattaagcctaaagaaggaaaaactaagtcatttcagatt |
3755720 |
T |
 |
| Q |
202 |
ctactggcacgacatag |
218 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3755719 |
ctactggcacgacatag |
3755703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 107 - 217
Target Start/End: Complemental strand, 3762935 - 3762822
Alignment:
| Q |
107 |
tcatcatcagaaaatgatgacacttttgaatttgttcgtcctatagaccgcaaattattaagccta---aagaaggaaaaactaagtcatttcagattct |
203 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||||||||| ||||||||||| || ||| ||||| ||||||||||||||||| ||||| ||||||| |
|
|
| T |
3762935 |
tcatcatcagaaaatgaagaaacttttgattttgttcgtccaatagaccgcaagttgttaggcctaaacaagaaggaaaaactaagccattttagattct |
3762836 |
T |
 |
| Q |
204 |
actggcacgacata |
217 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
3762835 |
actggcatgacata |
3762822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 71 - 210
Target Start/End: Complemental strand, 3751989 - 3751844
Alignment:
| Q |
71 |
cttcccctctcatgcaacaccatcacttcaacatcatca---tcatcagaaaatgatgacacttttgaatttgttcgtcctatagaccgcaaattattaa |
167 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||||||| | |||| |||||| | || |||||||| ||||||||||| |||||||||||||| |||| |
|
|
| T |
3751989 |
cttctcctctcttgcaacactctcacttcaacatcattacaatcattagaaaaacaagaaacttttgattttgttcgtccaatagaccgcaaattgttaa |
3751890 |
T |
 |
| Q |
168 |
gccta---aagaaggaaaaactaagtcatttcagattctactggca |
210 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
3751889 |
gcctaaacaagaaagaaaaactaagtcatttcagattctattggca |
3751844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 110 - 210
Target Start/End: Complemental strand, 3781320 - 3781217
Alignment:
| Q |
110 |
tcatcagaaaatgatgacacttttgaatttgttcgtcctatagaccgcaaattattaagccta---aagaaggaaaaactaagtcatttcagattctact |
206 |
Q |
| |
|
||||||||||| | |||||||| || ||||||||||| ||||| |||||||| ||| ||||| ||||| ||||| |||||||||||||||||||| | |
|
|
| T |
3781320 |
tcatcagaaaaacaagacactttcgattttgttcgtccgatagatcgcaaattgttaggcctaaacaagaaagaaaagctaagtcatttcagattctatt |
3781221 |
T |
 |
| Q |
207 |
ggca |
210 |
Q |
| |
|
|||| |
|
|
| T |
3781220 |
ggca |
3781217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 10731940 - 10731986
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
10731940 |
ctttttactacttcgatagaaccgtgcacttgcggttttactcatca |
10731986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 10945709 - 10945755
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
10945709 |
ctttttactacttcgatagaaccgtgcacttgcggttttactcatca |
10945755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 18079450 - 18079488
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18079450 |
tttttactacttcgatagaaccgtacacttgcggtttta |
18079488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 218
Target Start/End: Complemental strand, 3767336 - 3767225
Alignment:
| Q |
110 |
tcatcagaaaatgatgacacttttgaatttgttcgtcctatagaccgcaaattattaagcctaaa---gaaggaaaaactaagtcatttcagattctact |
206 |
Q |
| |
|
||||||||||| | ||||| |||| ||||||||||| ||||| ||||| || ||| ||||||| ||||||||| ||||||||||||| ||| || | |
|
|
| T |
3767336 |
tcatcagaaaaacaagacacagttgattttgttcgtccaatagatcgcaagttgttaggcctaaacaagaaggaaaagctaagtcatttcaaattttatt |
3767237 |
T |
 |
| Q |
207 |
ggcacgacatag |
218 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
3767236 |
ggcatgacatag |
3767225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 6519137 - 6519174
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6519137 |
ttttactacttcgatagaaccgtacacttgcggtttta |
6519174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 216
Target Start/End: Complemental strand, 3746165 - 3746021
Alignment:
| Q |
78 |
tctcatgcaacaccatcacttcaacatcatcatcatca---gaaaatgatgacacttttgaatttgttcgtcctatagaccgcaaattattaagcctaaa |
174 |
Q |
| |
|
|||| ||||||||| |||||||||| |||||| ||||| ||||| || || |||| ||| ||||||||| | ||||||| |||||| ||| |||||| |
|
|
| T |
3746165 |
tctcttgcaacaccctcacttcaacttcatcaccatcatttgaaaaagaagaaacttatgattttgttcgttcaatagaccccaaattgttacacctaaa |
3746066 |
T |
 |
| Q |
175 |
gaag---gaaaaactaagtcatttcagattctactggcacgacat |
216 |
Q |
| |
|
|| ||||| ||||||||||||||||||| ||||| ||||| |
|
|
| T |
3746065 |
caaccaagaaaagctaagtcatttcagattcttttggcatgacat |
3746021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 218
Target Start/End: Complemental strand, 3776986 - 3776896
Alignment:
| Q |
131 |
tttgaatttgttcgtcctatagaccgcaaattattaagcctaaa---gaaggaaaaactaagtcatttcagattctactggcacgacatag |
218 |
Q |
| |
|
||||| ||||||||||| ||||| ||||| || ||| ||||||| ||||||||| ||||||||||||| ||| || ||||| ||||||| |
|
|
| T |
3776986 |
tttgattttgttcgtccaatagatcgcaagttgttaggcctaaacaagaaggaaaagctaagtcatttcaaattatattggcatgacatag |
3776896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 7197982 - 7198021
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
7197982 |
ctttttactaattcgatagaactgtgcacttgcggtttta |
7198021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 9192985 - 9193031
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||| ||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
9192985 |
cttttcactacttcggtagaaccgtgcacttgcggttttactcatca |
9193031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 71
Target Start/End: Original strand, 16393431 - 16393477
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta-ctcatcac |
71 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
16393431 |
ttttactactccgatagaaccgtacacttgcggttttatctcatcac |
16393477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 24124563 - 24124525
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
24124563 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
24124525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 10632133 - 10632170
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
10632133 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
10632170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 15255710 - 15255747
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
15255710 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
15255747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 36515304 - 36515267
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
36515304 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
36515267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 62
Target Start/End: Complemental strand, 14690157 - 14690121
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttt |
62 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| |
|
|
| T |
14690157 |
ttttactacttcgatagaaccgtgcacttgcggtttt |
14690121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 63
Target Start/End: Original strand, 15249084 - 15249120
Alignment:
| Q |
27 |
tttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||| |
|
|
| T |
15249084 |
tttactacttcgatagaaccgtgcacttgcggtttta |
15249120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 19)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 29254731 - 29254777
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
29254731 |
ctttttactacttcggtagaactgtgcacttgcggttttactcatca |
29254777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 24 - 71
Target Start/End: Original strand, 26139417 - 26139464
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatcac |
71 |
Q |
| |
|
||||||| |||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
26139417 |
ctttttattacttcgatagaaccgtgcacttgcggttttactcatcac |
26139464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 18327318 - 18327280
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18327318 |
tttttactacttcgatagaactgtgcacttgcggtttta |
18327280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 70
Target Start/End: Complemental strand, 20217823 - 20217777
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
20217823 |
ctttttactacttcggtagaaccgtgcacttgcggttttactcatca |
20217777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 70
Target Start/End: Complemental strand, 22111848 - 22111802
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
22111848 |
ctttttactacttcggtagaaccgtgcacttgcggttttactcatca |
22111802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 19563230 - 19563193
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19563230 |
ttttactacttcgatagaaccgtacacttgcggtttta |
19563193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 25 - 70
Target Start/End: Complemental strand, 24544967 - 24544922
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
|||||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
24544967 |
tttttactacttcggtagaaccgtgcacttgcggttttactcatca |
24544922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 25922725 - 25922681
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcat |
68 |
Q |
| |
|
||||| ||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
25922725 |
cttttaactacttcggtagaactgtgcacttgcggttttactcat |
25922681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 71
Target Start/End: Original strand, 6795698 - 6795741
Alignment:
| Q |
28 |
ttactacttcgatagaactgtacacttgcggttttactcatcac |
71 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||||| |
|
|
| T |
6795698 |
ttactacttcggtagaaccgtgcacttgcggttttactcatcac |
6795741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 71
Target Start/End: Original strand, 26018713 - 26018760
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatcac |
71 |
Q |
| |
|
||||||| |||||||||||||| || |||||||||||||| ||||||| |
|
|
| T |
26018713 |
ctttttattacttcgatagaaccgtgcacttgcggttttaatcatcac |
26018760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 28079835 - 28079797
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
28079835 |
tttttactacttcggtagaactgtgcacttgcggtttta |
28079797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 5670219 - 5670182
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
5670219 |
ttttactacttcgatagaaccgtacacttgcagtttta |
5670182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 12473864 - 12473827
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
12473864 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
12473827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 15154449 - 15154486
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
15154449 |
ttttgctacttcgatagaaccgtacacttgcggtttta |
15154486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 15158907 - 15158944
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
15158907 |
ttttgctacttcgatagaaccgtacacttgcggtttta |
15158944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 18280088 - 18280051
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
18280088 |
ttttactaattcgatagaaccgtacacttgcggtttta |
18280051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 18733113 - 18733150
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
18733113 |
ttttactactccgatagaaccgtacacttgcggtttta |
18733150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 19560226 - 19560189
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
19560226 |
ttttactacttcgatagaaccgtaaacttgcggtttta |
19560189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 63
Target Start/End: Complemental strand, 30670605 - 30670565
Alignment:
| Q |
23 |
actttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||| |||| || |||||||||||||| |
|
|
| T |
30670605 |
actttttactacttcgattgaaccgtgcacttgcggtttta |
30670565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 17)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 73
Target Start/End: Complemental strand, 20224574 - 20224525
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatcactt |
73 |
Q |
| |
|
||||||||||||||| |||||| || |||||||||||||||||||||||| |
|
|
| T |
20224574 |
ctttttactacttcggtagaaccgtgcacttgcggttttactcatcactt |
20224525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 5688441 - 5688479
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5688441 |
tttttactacttcgatagaaccgtacacttgcggtttta |
5688479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 17051487 - 17051533
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
17051487 |
ctttttactacttcggtagaaccgtgcacttgcggttttactcatca |
17051533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 17481241 - 17481278
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17481241 |
ttttactacttcgatagaaccgtacacttgcggtttta |
17481278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 20151260 - 20151297
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20151260 |
ttttactacttcgatagaaccgtacacttgcggtttta |
20151297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 14347423 - 14347384
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
14347423 |
ctttttactacttcaatagaaccgtacacttgcggtttta |
14347384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 71
Target Start/End: Original strand, 22039573 - 22039620
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatcac |
71 |
Q |
| |
|
||||||||| ||||| |||||| || |||||||||||||||||||||| |
|
|
| T |
22039573 |
ctttttacttcttcggtagaaccgtgcacttgcggttttactcatcac |
22039620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 71
Target Start/End: Original strand, 27407959 - 27408006
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatcac |
71 |
Q |
| |
|
||||||||||||| |||||||| || |||||||| ||||||||||||| |
|
|
| T |
27407959 |
ctttttactacttagatagaaccgtgcacttgcgattttactcatcac |
27408006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 2782014 - 2782052
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
2782014 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
2782052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 5225807 - 5225769
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
5225807 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
5225769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 70
Target Start/End: Complemental strand, 11823794 - 11823756
Alignment:
| Q |
32 |
tacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
11823794 |
tacttcggtagaactgtgcacttgcggttttactcatca |
11823756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 13419135 - 13419181
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
|||||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
13419135 |
ctttttactacttcagtagaaccgtgcacttgcggttttactcatca |
13419181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 14494136 - 14494098
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
14494136 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
14494098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 19655424 - 19655386
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
19655424 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
19655386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 20155708 - 20155745
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
20155708 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
20155745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 43496967 - 43497004
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
43496967 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
43497004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 53354125 - 53354088
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
53354125 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
53354088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 15)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 18884719 - 18884682
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18884719 |
ttttactacttcgatagaactgtacacttgcggtttta |
18884682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 41462494 - 41462533
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41462494 |
ctttttactacttcgatagaaccgtacacttgcggtttta |
41462533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 39285945 - 39285907
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39285945 |
tttttactacttcgatagaaccgtacacttgcggtttta |
39285907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 16364677 - 16364640
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16364677 |
ttttactacttcgatagaaccgtacacttgcggtttta |
16364640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 1593926 - 1593964
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
1593926 |
tttttactacttcggtagaaccgtacacttgcggtttta |
1593964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 70
Target Start/End: Original strand, 16069182 - 16069224
Alignment:
| Q |
28 |
ttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
16069182 |
ttactacttcggtagaaccgtgcacttgcggttttactcatca |
16069224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 19787605 - 19787567
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
19787605 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
19787567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 20413004 - 20413050
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||||||| || ||| || ||||||||||||||||||||| |
|
|
| T |
20413004 |
ctttttactacttcggtaaaaccgtgcacttgcggttttactcatca |
20413050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 22635050 - 22635012
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
22635050 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
22635012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 25727704 - 25727742
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
25727704 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
25727742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 25736112 - 25736150
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
25736112 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
25736150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 4029066 - 4029103
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
4029066 |
ttttaatacttcgatagaaccgtacacttgcggtttta |
4029103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 8654523 - 8654560
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
8654523 |
ttttactacttcgatagaaccgtacacttgtggtttta |
8654560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 8952815 - 8952778
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
8952815 |
ttttactactttgatagaaccgtacacttgcggtttta |
8952778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 46090917 - 46090954
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
46090917 |
ttttactacttcgatagaaccgtacacttgcgatttta |
46090954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 71
Target Start/End: Complemental strand, 1148 - 1100
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta-ctcatcac |
71 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
1148 |
ctttttactacttcgatagaaccgtacacttgcggttttatctcatcac |
1100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 20)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 75
Target Start/End: Complemental strand, 9258007 - 9257955
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta-ctcatcacttcc |
75 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
9258007 |
ctttttactacttcgatagaaccgtacacttgcggttttatcccatcacttcc |
9257955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 75
Target Start/End: Original strand, 9312246 - 9312298
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta-ctcatcacttcc |
75 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
9312246 |
ctttttactacttcgatagaaccgtacacttgcggttttatcccatcacttcc |
9312298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 5398489 - 5398527
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5398489 |
tttttactacttcgatagaaccgtacacttgcggtttta |
5398527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 13457449 - 13457487
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13457449 |
tttttactacttcgatagaactgtgcacttgcggtttta |
13457487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 14941068 - 14941031
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14941068 |
ttttactacttcgatagaaccgtacacttgcggtttta |
14941031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 15368661 - 15368624
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15368661 |
ttttactacttcgatagaaccgtacacttgcggtttta |
15368624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 20114486 - 20114523
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20114486 |
ttttactacttcgatagaaccgtacacttgcggtttta |
20114523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 21507749 - 21507786
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21507749 |
ttttactacttcgatagaaccgtacacttgcggtttta |
21507786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 70
Target Start/End: Original strand, 46274845 - 46274889
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
46274845 |
ttttactacttcggtagaaccgtgcacttgcggttttactcatca |
46274889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 71
Target Start/End: Original strand, 9010369 - 9010416
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta-ctcatcac |
71 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
9010369 |
tttttactacttcgatagaaccgtgcacttgcggttttatctcatcac |
9010416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 70
Target Start/End: Complemental strand, 8786620 - 8786574
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||||||| |||||| || |||||| |||||||||||||| |
|
|
| T |
8786620 |
ctttttactacttcggtagaaccgtgcacttgtggttttactcatca |
8786574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 9193279 - 9193317
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
9193279 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
9193317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 9562599 - 9562645
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
9562599 |
ctttttactacttcggtagaaccttgcacttgcggttttactcatca |
9562645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 12797883 - 12797921
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
12797883 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
12797921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 16076138 - 16076100
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
16076138 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
16076100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 33611586 - 33611548
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
33611586 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
33611548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 5841437 - 5841474
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
5841437 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
5841474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 12547632 - 12547595
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
12547632 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
12547595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 38387484 - 38387447
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
38387484 |
ttttactacttcgatagaaccgtacacttgtggtttta |
38387447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 48781198 - 48781161
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
48781198 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
48781161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0713 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0713
Description:
Target: scaffold0713; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 24 - 71
Target Start/End: Complemental strand, 6039 - 5992
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatcac |
71 |
Q |
| |
|
||||||| |||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
6039 |
ctttttattacttcgatagaaccgtgcacttgcggttttactcatcac |
5992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 24 - 71
Target Start/End: Complemental strand, 110881 - 110834
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatcac |
71 |
Q |
| |
|
||||||||||||||| |||||| || |||||||||||||||||||||| |
|
|
| T |
110881 |
ctttttactacttcggtagaaccgtgcacttgcggttttactcatcac |
110834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 19)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 43835617 - 43835578
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43835617 |
ctttttactacttcgatagaaccgtacacttgcggtttta |
43835578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 37818502 - 37818540
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37818502 |
tttttactacttcgatagaactgtgcacttgcggtttta |
37818540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 14350967 - 14350930
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14350967 |
ttttactacttcgatagaaccgtacacttgcggtttta |
14350930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 18229965 - 18229928
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18229965 |
ttttactacttcgatagaaccgtacacttgcggtttta |
18229928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 21328084 - 21328047
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21328084 |
ttttactacttcgatagaactgtgcacttgcggtttta |
21328047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 22831913 - 22831950
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22831913 |
ttttactacttcgatagaaccgtacacttgcggtttta |
22831950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 18400043 - 18400079
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttt |
62 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18400043 |
ttttactacttcgatagaaccgtacacttgcggtttt |
18400079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 73
Target Start/End: Complemental strand, 39730036 - 39729988
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta-ctcatcactt |
73 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |||||||||| |
|
|
| T |
39730036 |
ttttactacttcgatagaaccgttcacttgcggttttatctcatcactt |
39729988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 21950877 - 21950916
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
21950877 |
ctttttactacttcgatagaaccgtgcacttgcggtttta |
21950916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 21956679 - 21956718
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
21956679 |
ctttttactacttcgatagaaccgtgcacttgcggtttta |
21956718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 22285741 - 22285780
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
22285741 |
ctttttactacttcgataaaactgtgcacttgcggtttta |
22285780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 22371323 - 22371362
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
22371323 |
ctttttactacttcgatagaaccgtgcacttgcggtttta |
22371362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 26013680 - 26013719
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
26013680 |
ctttttacaacttcgatagaaccgtacacttgcggtttta |
26013719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 70
Target Start/End: Complemental strand, 1989822 - 1989780
Alignment:
| Q |
28 |
ttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
1989822 |
ttactacttcggtagaaccgtgcacttgcggttttactcatca |
1989780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 17515198 - 17515160
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17515198 |
tttttactacttcgatagaagcgtacacttgcggtttta |
17515160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 20037805 - 20037767
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
20037805 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
20037767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 21842347 - 21842309
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
21842347 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
21842309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 21858159 - 21858121
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
21858159 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
21858121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 22725161 - 22725117
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcat |
68 |
Q |
| |
|
||||||||||||||| |||||| || |||||||||||||||||| |
|
|
| T |
22725161 |
ctttttactacttcggtagaaccgtttacttgcggttttactcat |
22725117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0388 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0388
Description:
Target: scaffold0388; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 16298 - 16260
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16298 |
tttttactacttcgatagaaccgtacacttgcggtttta |
16260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0230 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0230
Description:
Target: scaffold0230; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 17037 - 17075
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17037 |
tttttactacttcgatagaactgtgcacttgcggtttta |
17075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 8165 - 8127
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8165 |
tttttactacttcgatagaaccgtacacttgcggtttta |
8127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 10)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 70
Target Start/End: Complemental strand, 2952974 - 2952928
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||||||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
2952974 |
ctttttactacttcggtagaaccgtacacttgcagttttactcatca |
2952928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 20739086 - 20739132
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
20739086 |
ctttttactacttcggtagaaccgtgcacttgcggttttactcatca |
20739132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 70
Target Start/End: Complemental strand, 31757479 - 31757433
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||||||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
31757479 |
ctttttactacttcggtagaaccgtacacttgcagttttactcatca |
31757433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 20246327 - 20246364
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20246327 |
ttttactacttcgatagaaccgtacacttgcggtttta |
20246364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 12323025 - 12323063
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
12323025 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
12323063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 70
Target Start/End: Complemental strand, 20167521 - 20167479
Alignment:
| Q |
28 |
ttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
20167521 |
ttactacttcggtagaaccgtgcacttgcggttttactcatca |
20167479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 20449157 - 20449119
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
20449157 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
20449119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 21999849 - 21999811
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
21999849 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
21999811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 71
Target Start/End: Complemental strand, 42789155 - 42789109
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta-ctcatcac |
71 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
42789155 |
ttttactacttcgatagaaccgtgcacttgcggttttatctcatcac |
42789109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 14483159 - 14483196
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
14483159 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
14483196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 17)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 71
Target Start/End: Complemental strand, 23698156 - 23698110
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggttttactcatcac |
71 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
23698156 |
tttttactacttcggtagaaccatacacttgcggttttactcatcac |
23698110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 70
Target Start/End: Complemental strand, 41652958 - 41652912
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
41652958 |
ctttttactacttcgataggaccgtgcacttgcggttttactcatca |
41652912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 25 - 70
Target Start/End: Original strand, 22438066 - 22438111
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
|||||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
22438066 |
tttttactacttcggtagaaccgtgcacttgcggttttactcatca |
22438111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 25038256 - 25038219
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25038256 |
ttttactacttcgatagaaccgtacacttgcggtttta |
25038219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 64
Target Start/End: Complemental strand, 20692 - 20652
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttac |
64 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
20692 |
ctttttactacttcggtagaactgtgcacttgcggttttac |
20652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 71
Target Start/End: Original strand, 22329211 - 22329258
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatcac |
71 |
Q |
| |
|
||||||||||||||| |||||| || ||||| |||||||||||||||| |
|
|
| T |
22329211 |
ctttttactacttcggtagaaccgtgcacttacggttttactcatcac |
22329258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 23341317 - 23341356
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
23341317 |
ctttttactacttcgatagaaccgtgcacttgcggtttta |
23341356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 63
Target Start/End: Complemental strand, 25369652 - 25369617
Alignment:
| Q |
28 |
ttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25369652 |
ttactacttcgatagaactgtgcacttgcggtttta |
25369617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 71
Target Start/End: Original strand, 25482135 - 25482182
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta-ctcatcac |
71 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
25482135 |
tttttactacttcgatagaaccgtgcacttgcggttttatctcatcac |
25482182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 71
Target Start/End: Original strand, 25489741 - 25489788
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta-ctcatcac |
71 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
25489741 |
tttttactacttcgatagaaccgtgcacttgcggttttatctcatcac |
25489788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 20244846 - 20244808
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
20244846 |
tttttactacttcggtagaaccgtacacttgcggtttta |
20244808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 23800223 - 23800185
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
23800223 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
23800185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 70
Target Start/End: Complemental strand, 25857923 - 25857877
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggttttactcatca |
70 |
Q |
| |
|
||||||||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
25857923 |
ctttttactacttcggtagaaccgtgaacttgcggttttactcatca |
25857877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 40916131 - 40916093
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
40916131 |
tttttactatttcgatagaaccgtacacttgcggtttta |
40916093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 23634692 - 23634729
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23634692 |
ttttactacttcgatagaaccttacacttgcggtttta |
23634729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 23649518 - 23649555
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
23649518 |
ttttactacttcgatagatccgtacacttgcggtttta |
23649555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 72
Target Start/End: Complemental strand, 30313508 - 30313460
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta-ctcatcact |
72 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||| ||||||||| |
|
|
| T |
30313508 |
tttttactacttcgatataaccgtgcacttgcggttttatctcatcact |
30313460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0673 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0673
Description:
Target: scaffold0673; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 2537 - 2500
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2537 |
ttttactacttcgatagaactgtgcacttgcggtttta |
2500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0637 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0637
Description:
Target: scaffold0637; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 2165 - 2128
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2165 |
ttttactacttcgatagaaccgtacacttgcggtttta |
2128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0560 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0560
Description:
Target: scaffold0560; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 25 - 62
Target Start/End: Original strand, 2571 - 2608
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttt |
62 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2571 |
tttttactacttcgatagaaccgtacacttgcggtttt |
2608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0512 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0512
Description:
Target: scaffold0512; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 6499 - 6536
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6499 |
ttttactacttcgatagaaccgtacacttgcggtttta |
6536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 25 - 73
Target Start/End: Original strand, 135110 - 135159
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta-ctcatcactt |
73 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |||||||||| |
|
|
| T |
135110 |
tttttactacttcgatagaaccgtgcacttgcggttttatctcatcactt |
135159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 163251 - 163288
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
163251 |
ttttactacttcgatagaaccgtacacttgcggtttta |
163288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1095 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1095
Description:
Target: scaffold1095; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 71
Target Start/End: Original strand, 198 - 246
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta-ctcatcac |
71 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| |||||||| |
|
|
| T |
198 |
ctttttactacttcggtagaactatacacttgcggttttatctcatcac |
246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0278 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0278
Description:
Target: scaffold0278; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 11884 - 11845
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
11884 |
ctttttacaacttcgatagaactgtgcacttgcggtttta |
11845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 69999 - 69960
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
69999 |
ctttttactacttcgatagaaccgtacacttgcgatttta |
69960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 61
Target Start/End: Complemental strand, 149870 - 149835
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggttt |
61 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
149870 |
ttttactacttcgatagaaccgtacacttgcggttt |
149835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 60
Target Start/End: Complemental strand, 245236 - 245202
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtt |
60 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
245236 |
ttttactacttcgatagaaccgtacacttgcggtt |
245202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 182017 - 181978
Alignment:
| Q |
24 |
ctttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
182017 |
ctttttactacttcgatagaaccgtgcacttgcggtttta |
181978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1403 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1403
Description:
Target: scaffold1403; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 1692 - 1654
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
1692 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
1654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0509 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0509
Description:
Target: scaffold0509; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 435 - 473
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
435 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0471 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0471
Description:
Target: scaffold0471; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 9151 - 9113
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
9151 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
9113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0360 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0360
Description:
Target: scaffold0360; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 5446 - 5408
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
5446 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
5408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0218 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0218
Description:
Target: scaffold0218; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 16941 - 16903
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
16941 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
16903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0096
Description:
Target: scaffold0096; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 37351 - 37313
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
37351 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
37313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0084 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0084
Description:
Target: scaffold0084; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 44627 - 44665
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
44627 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
44665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 17322 - 17360
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
17322 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
17360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 79191 - 79229
Alignment:
| Q |
25 |
tttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
79191 |
tttttactacttcgatagaaccgtgcacttgcggtttta |
79229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 111325 - 111362
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
111325 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
111362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1496 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold1496
Description:
Target: scaffold1496; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 1679 - 1642
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
1679 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
1642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0532 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0532
Description:
Target: scaffold0532; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 4440 - 4403
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
4440 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
4403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0317 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0317
Description:
Target: scaffold0317; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 13561 - 13524
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
13561 |
ttttactacttcgatataaccgtacacttgcggtttta |
13524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0113 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: scaffold0113
Description:
Target: scaffold0113; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 803 - 840
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
803 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0113; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 42824 - 42787
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
42824 |
ttttactacttcgataggactgtgcacttgcggtttta |
42787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0042
Description:
Target: scaffold0042; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 55992 - 55955
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
55992 |
ttttactacttcgataaaaccgtacacttgcggtttta |
55955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 34747 - 34784
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
34747 |
ttttactacttcgatagaaccgtacacttgcggattta |
34784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 216617 - 216580
Alignment:
| Q |
26 |
ttttactacttcgatagaactgtacacttgcggtttta |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
216617 |
ttttactacttcgatagaaccgtgcacttgcggtttta |
216580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University