View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8773_high_5 (Length: 219)

Name: NF8773_high_5
Description: NF8773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8773_high_5
NF8773_high_5
[»] chr8 (1 HSPs)
chr8 (82-206)||(4367339-4367463)


Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 82 - 206
Target Start/End: Original strand, 4367339 - 4367463
Alignment:
82 tttaatcgtggtggtcatagcattgataaggctaatgctggtgaagaagatagcaatggctttgttattcctgaaaaggttcattttttgattccatgct 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
4367339 tttaatcgtggtggtcatagcattgataaggctaatgctggtgaagaagatagcaatggctttgttattcctgaaaaggttcattttttgattccatgca 4367438  T
182 agtgtttatcttttagttttaagtg 206  Q
    |||||||||||||||||||||||||    
4367439 agtgtttatcttttagttttaagtg 4367463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University