View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8773_low_6 (Length: 329)
Name: NF8773_low_6
Description: NF8773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8773_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 314
Target Start/End: Original strand, 24984731 - 24985044
Alignment:
| Q |
1 |
tcccacacttttgcgcgttctccaattttttcattttattatcgttttagattttataatccaaacaatacgtccataccaacatatacacactttcact |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24984731 |
tcccacacttttgcgcgtcctccaattttttcattttattatcgttttacattttataatccaaacaatacgtccataccaacatatacacactttcact |
24984830 |
T |
|
| Q |
101 |
catttcccattttcaaaatttaatccaaggatgcagcgctgccggaaggcaaacctatgagtggctttagatattagacatttatacaacatttttaaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24984831 |
catttcccattttcaaaatttaatccaaggatgcagcgctgccggaaggcaaatctatgagtggctttagatattagacatttatacaacatttttaaga |
24984930 |
T |
|
| Q |
201 |
ttaatttgccagataattggtgttgtggctatcatttgcttaatagtttatctcatttggattatatttgaataagttttttaggataatattatgtgtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24984931 |
ttaatttgccagataattggtgttgtggctatcatttgcttaatagtttatctcatttggattatatttgaataagttttttaggataatattatgtgtt |
24985030 |
T |
|
| Q |
301 |
aacacgtggttatt |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
24985031 |
aacacgtggttatt |
24985044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University