View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8775_high_1 (Length: 228)
Name: NF8775_high_1
Description: NF8775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8775_high_1 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 6935942 - 6935715
Alignment:
| Q |
1 |
tcacctccatttccatagactgcaatatgttatcatttttgggtggaacaatcaatccctcactctcttgacctactgtcttcaacttaataccactcac |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6935942 |
tcacctccatttccatagacttcaatatgttatcatttttgggtggaacaatcaatccctcactctcttgacctactgtcttcaacttaataccactcac |
6935843 |
T |
|
| Q |
101 |
tgagttctcacttccatagcgaggcgatgaacttccggatccaactgatgaacccaagcatatggcttcctccatagttgcccatgcacggcgtctgatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6935842 |
tgagttctcacttccatagcgaggcgatgaacttccggatccaactgatgaacccaagcatatggcttcctccatagttgcccatgcacggcgtctgatg |
6935743 |
T |
|
| Q |
201 |
tactccagctcctcagcaacttacatca |
228 |
Q |
| |
|
||||||||||||||||| |||| ||||| |
|
|
| T |
6935742 |
tactccagctcctcagccacttccatca |
6935715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 220
Target Start/End: Original strand, 33644079 - 33644179
Alignment:
| Q |
120 |
cgaggcgatgaacttccggatccaactgatgaacccaagcatatggcttcctccatagttgcccatgcacggcgtctgatgtactccagctcctcagcaa |
219 |
Q |
| |
|
||||||||||| | | |||||||||| ||||| |||| |||||| | ||||||||| ||||||||| | | |||||||| | || ||||||||||||| |
|
|
| T |
33644079 |
cgaggcgatgagcatgcggatccaaccgatgatcccatgcatatagtttcctccatcgttgcccatccgctacgtctgatatgatctagctcctcagcaa |
33644178 |
T |
|
| Q |
220 |
c |
220 |
Q |
| |
|
| |
|
|
| T |
33644179 |
c |
33644179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University