View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8776_high_4 (Length: 259)
Name: NF8776_high_4
Description: NF8776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8776_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 35 - 211
Target Start/End: Complemental strand, 44006097 - 44005921
Alignment:
| Q |
35 |
gagctaacacagtaataattactatagacatggcagttgcttaaacaaaataaatctgaattatttgcataatcatgttactttttattctcccgttata |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44006097 |
gagctaacacagtaataattactatagacatggcagttgcttaaacaaaataaatctgaattatttgcataatcatgttactttttattctcccgttata |
44005998 |
T |
 |
| Q |
135 |
gatcaataccaacaaaagtaaagacaatggatatgtaagaacatagccatgcagatgacactaggaattcctttttt |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44005997 |
gatcaatatcaacaaaagtaaagacaatggatatgtaagaacatagccatgcagatgacactaggaattcctttttt |
44005921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University