View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8776_low_6 (Length: 229)

Name: NF8776_low_6
Description: NF8776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8776_low_6
NF8776_low_6
[»] chr2 (1 HSPs)
chr2 (11-229)||(17772985-17773203)
[»] chr4 (1 HSPs)
chr4 (11-165)||(52218760-52218914)


Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 11 - 229
Target Start/End: Original strand, 17772985 - 17773203
Alignment:
11 gaaactcttgctcccgagactgttggatcaactgcactggttgcaattttgactcaaaaccacataatagttgcgaattgcggtgattcaagagcagtct 110  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||    
17772985 gaaactcttgctcccgagactgttggatccactgcactggttgcaattttgactcaaaaccacataatagttgcgaattgtggggattcaagagcggtct 17773084  T
111 tgtgtcgaggaaaagaagcacttccgttgtctatcgaccaaaaagtaaggcatttgtttcacaatttgtttgctggactcttagaagctgaagtgatctg 210  Q
    |||||||||||||||||||||| || ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17773085 tgtgtcgaggaaaagaagcactgccattgtcgattgaccaaaaagtaaggcatttgtttcacaatttgtttgctggactcttagaagctgaagtgatctg 17773184  T
211 atgcaggaaactttatttc 229  Q
    |||||||||||||||||||    
17773185 atgcaggaaactttatttc 17773203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 11 - 165
Target Start/End: Complemental strand, 52218914 - 52218760
Alignment:
11 gaaactcttgctcccgagactgttggatcaactgcactggttgcaattttgactcaaaaccacataatagttgcgaattgcggtgattcaagagcagtct 110  Q
    |||||||||||||| ||||||| ||| || |||||| ||||||| ||||| | ||||| ||||||||| ||||| ||||| || ||||| ||||| ||||    
52218914 gaaactcttgctcctgagactgctggctccactgcagtggttgccattttaaatcaaacccacataattgttgcaaattgtggggattcgagagctgtct 52218815  T
111 tgtgtcgaggaaaagaagcacttccgttgtctatcgaccaaaaagtaaggcattt 165  Q
    ||| ||| || ||||||||  || ||||||||   ||||| ||||||||||||||    
52218814 tgtatcgtgggaaagaagccattgcgttgtcttctgaccacaaagtaaggcattt 52218760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University