View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8777_low_10 (Length: 223)
Name: NF8777_low_10
Description: NF8777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8777_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 43472114 - 43472324
Alignment:
| Q |
1 |
attagtactcaagacaataagnnnnnnnggtaagcattatgcatattttatatatcatttctagtatctgtgagttttgaatttctacatttatgtttag |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43472114 |
attagtactcaagacaataagttttttaggtaagcattatgcatattttatatatcatttctagtatctgtgagttttgaatttctacatttatgtttgg |
43472213 |
T |
|
| Q |
101 |
tttacagatgca-tttgtatttcttatattgtgtgcttttttaactgtatagtgcttaatttagtgaattatgtgtttagaaaacttagatcaagtgaat |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43472214 |
tttacagatgccgtttgtatttcttatattgtgtgctttttttactgtatagtgcttaatttagtgaattatgtgtttagaaaacttagatcaagtgaat |
43472313 |
T |
|
| Q |
200 |
cttattgatgt |
210 |
Q |
| |
|
|||||| |||| |
|
|
| T |
43472314 |
cttatttatgt |
43472324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University