View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8777_low_4 (Length: 259)
Name: NF8777_low_4
Description: NF8777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8777_low_4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 747852 - 747594
Alignment:
| Q |
1 |
caagaacttgttcatatctcattcaatttgacacatcgtcatatcagcaaagcactcttcgcctcctcaggtctctcgtatacagtcgcgaacccacgag |
100 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
747852 |
caagaactagttcatatctcattcaatatgacacaccgtcacatcagcaaagcactcttcgcctcctcaggtctctcatatacagtcgcgaacccacgag |
747753 |
T |
 |
| Q |
101 |
ttcgtgctgcatacgaggattgtcttgaactaatggacgagtccatggatgctatcatatcatccatggattctctcatgaccacgtcctcaactttatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
747752 |
ttcgtgctgcatacgaggattgtcttgaactaatggacgagtccatggatgctatcagatcatccatggactctctcatgaccacgtcctcaactttatc |
747653 |
T |
 |
| Q |
201 |
caacgacgacggagaatcaagacaattctccaatgtcgctggatcaaccgaggatgtga |
259 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
747652 |
caacgacgacggtgaatcaagacaattctccaatgtcgctggatcaactgaggacgtga |
747594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University