View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8777_low_7 (Length: 240)
Name: NF8777_low_7
Description: NF8777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8777_low_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 26491864 - 26491642
Alignment:
| Q |
18 |
tagaccacatgcatcaactcacaccacccatttcccacagaaatctgttatcttcttctatatacctcactgaagattatgctgctaaaatatcagacct |
117 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26491864 |
tagaccacatgcataatctcacaccacccatttcccacagaaatctgttatcttcttctatatacctaactgaagattatgctgctaaaatatcagacct |
26491765 |
T |
 |
| Q |
118 |
tagtttctgcactaacaaagttgatacaaagaacggttacgaaaaaacttcagcagaagaagtaaaggacaatgtatatagttttggtgtaatattattt |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26491764 |
tagtttctgcaccgacaaagttgatacaaagaaccgttacgaaaaaacttcagcagaagaagtaaaggacaatgtatatagttttggtgtaatattattt |
26491665 |
T |
 |
| Q |
218 |
gagttgataacaggaaaaattcc |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26491664 |
gagttgataacaggaaaaattcc |
26491642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University