View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8779_high_5 (Length: 288)
Name: NF8779_high_5
Description: NF8779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8779_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 28 - 271
Target Start/End: Complemental strand, 49655846 - 49655602
Alignment:
| Q |
28 |
tcttaaggggtggctcgaaaattcatcatttcccagcagagatggcttttctgaacagaaacttggagcaaatattcttgcatgttactacactgcacaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49655846 |
tcttaaggggtggctcgaaaattcatcatttcccagcagagatggcttttctgaacagaaacttggagcaaatattcttgcatgttactacactgcacaa |
49655747 |
T |
 |
| Q |
128 |
tttgaaatatgttttcaatcacaattcctctaaaactttgtttcacatgaggccaac-tccattcaaaatatggacctccgcgcgaaagattggagtcac |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49655746 |
tttgaaatatgttttcaatcacaattcctctaaaactttgtttcacatgaggccaacgtccattcaaaatatggacctccgcgcgaaagattggcgtcac |
49655647 |
T |
 |
| Q |
227 |
tctagagtaattcataagctctacatgcaaccatatgatcaatgt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49655646 |
tctagagtaattcataagctctacatgcaaccatatgatcaatgt |
49655602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University