View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8779_high_6 (Length: 279)
Name: NF8779_high_6
Description: NF8779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8779_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 266
Target Start/End: Original strand, 386022 - 386270
Alignment:
| Q |
18 |
caaggaaggttcggttgatcttgctttgaggtggctgcgtttcatgggttcgtcaggtatcagaacaaataattttataatccgacagttgtttgagtca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
386022 |
caaggaaggttcggttgatcttgctttgaggtggctgcgtttcatgggttcgtcaggtatcagaacaaataattttataatccgacagttgtttgagtca |
386121 |
T |
 |
| Q |
118 |
tgcatgaagaatgggatatacgagtcagccaagccacttcttgaaacatatgttaactccgctgcaaaagttgatttgattctttacacttcgattttag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
386122 |
tgcatgaagaatgggatatacgagtcagccaagccacttcttgaaacatatgttaactccgctgcaaaagttgatttcattctttacacttcgattttag |
386221 |
T |
 |
| Q |
218 |
cgcatcttgttaggtgtcaggatgaagagaatgagaggcatttgatgtc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
386222 |
cgcatcttgttaggtgtcaggatgaagagaatgagaggcatttgatgtc |
386270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 266
Target Start/End: Complemental strand, 38729520 - 38729272
Alignment:
| Q |
18 |
caaggaaggttcggttgatcttgctttgaggtggctgcgtttcatgggttcgtcaggtatcagaacaaataattttataatccgacagttgtttgagtca |
117 |
Q |
| |
|
|||||||||||| || |||||||||||||| ||||| |||||||||||||| ||||| |||||||| ||||||||||||||| | |||||||||||||| |
|
|
| T |
38729520 |
caaggaaggttcagtcgatcttgctttgagatggctacgtttcatgggttcctcagggatcagaaccaataattttataatcaggcagttgtttgagtcg |
38729421 |
T |
 |
| Q |
118 |
tgcatgaagaatgggatatacgagtcagccaagccacttcttgaaacatatgttaactccgctgcaaaagttgatttgattctttacacttcgattttag |
217 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38729420 |
tgcatgaaaaatgggatatacgaatcagccaagcctcttcttgaaacatatgtgaactccgctgcaaaagttgatttgatactttacacttcgattttag |
38729321 |
T |
 |
| Q |
218 |
cgcatcttgttaggtgtcaggatgaagagaatgagaggcatttgatgtc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38729320 |
cgcatcttgttaggtgtcaggatgaagagaatgagaggcatttgatgtc |
38729272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University