View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8779_low_12 (Length: 301)
Name: NF8779_low_12
Description: NF8779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8779_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 280
Target Start/End: Complemental strand, 45565754 - 45565492
Alignment:
| Q |
18 |
aattctgcgtgcaaagagatgatgttgggcgaatggatgagaatgtggggtttgcgaattctctaacagatcaaagtttttctttgaagtgtgcttggag |
117 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565754 |
aattctgcgtgcaaagagatgatgttcggtgaatggatgagaatgtggggtttgcgaattctgtaacagatcaaagtttttctttgaagtgtgcttggag |
45565655 |
T |
|
| Q |
118 |
gtattcttcctactcttatgagacttcaagagagaggagttctatgttcaaatggatgtccccattgtgaaacaaactatgagaacgattggatgtaaag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565654 |
gtattcttcctactcttatgagacttcaaaagagaggagttccatgttcaaatggatgtccccattgtgaaacaaactatgagaacgattggatgtaaag |
45565555 |
T |
|
| Q |
218 |
cggcaaaacaaatatggtgcgaggctgatctgtgggattcagttagcagaggcgcaggtgctg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565554 |
cggcaaaacaaatatggtgcgaggctgatctgtgggattcagttagcagaggcgcaggtgctg |
45565492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 177 - 209
Target Start/End: Original strand, 45286940 - 45286972
Alignment:
| Q |
177 |
ccccattgtgaaacaaactatgagaacgattgg |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
45286940 |
ccccattgtgaaacaaactacgagaacgattgg |
45286972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University