View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8779_low_16 (Length: 275)
Name: NF8779_low_16
Description: NF8779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8779_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 32 - 258
Target Start/End: Complemental strand, 31176763 - 31176540
Alignment:
| Q |
32 |
cattaatttttaatttgtatcgcaaatgaattactataaaatatgacaattgacaaagagaatcctatcctatttatgacaaattctagtttatgatcat |
131 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31176763 |
cattaatttttaatttgtatcgcaaatgactta---taaaatatgacaattgacaaagagaatcctatcctatttatgacaaattctagtttatgatcat |
31176667 |
T |
 |
| Q |
132 |
gaagtatcattagtactacctttgatgaggccaagcaagctacgagctttcatgtggactgtggaggatggccccatgatattttacagttgctgattag |
231 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31176666 |
gaagtataattggtactacctttgatgaggccaagcaagctacgagctttcatgtggactgtggaggatggccccatgatattttacagttgctgattag |
31176567 |
T |
 |
| Q |
232 |
atctattgacttgcacaccgacatatc |
258 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31176566 |
atctattgacttgcacaccgacatatc |
31176540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University