View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8779_low_19 (Length: 253)
Name: NF8779_low_19
Description: NF8779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8779_low_19 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 49041903 - 49042138
Alignment:
| Q |
18 |
aggagttgggttaaacaaactacaatttacaacaagaatgtcaatgtctcttggattaacacatgttttagcaaaaagtgcgtctaatgctccaaacatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49041903 |
aggagttgggttaaacaaactacaatttacaacaagaatgtcaatgtctcttggattaacacctgttttagcaaaaagtgcgtctaatgatccaaacatt |
49042002 |
T |
|
| Q |
118 |
acagcttcggcttctaaacgcgcttctttcatgcatagatttggtggacttgacattattccgtttggcaaggaagtttcatcaccaagacctgctcttg |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49042003 |
acagattcggcttctaaacgcgcttctttcatgcatagatttggtggacttgacattattccgtttggcaaggaagtttcatcaccaagacctgctcttg |
49042102 |
T |
|
| Q |
218 |
acaaaatgcggcgttgaaattgaagtgtttcttctc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
49042103 |
acaaaatgcggcgttgaaattgaagtgtttcttctc |
49042138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 26463890 - 26463824
Alignment:
| Q |
18 |
aggagttgggttaaacaaactacaatttacaacaagaatgtcaatgtctcttggattaacacatgtt |
84 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
26463890 |
aggagttgggttatacaaactacaatttacaacaaggatgtcaatgtctcttgaattaacacatgtt |
26463824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University