View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8779_low_5 (Length: 392)
Name: NF8779_low_5
Description: NF8779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8779_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 19 - 381
Target Start/End: Complemental strand, 10981175 - 10980813
Alignment:
| Q |
19 |
tgttctaactattgaaggagttgattccgataacaaggacaaagttggtgtagccgattcagatgtaacactgattagcaagtctttggatgacattgat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10981175 |
tgttctaactattgaaggagttgattccgataacaaggacaaagttggtgtagccgattcagatgtaacaccgattagcaagtctttggatgacattgat |
10981076 |
T |
|
| Q |
119 |
ctggatgggtgtgaagcatcgagcacaaaagaaccaaaattggtgtctgcttcaaaggtagctgttgttgctccagttgtgactccgaacactccaaact |
218 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| |
|
|
| T |
10981075 |
gtaggtgggtgtgaagcatcgagcacaaaagaaccaaaattggtgtctgcttcaaaggtagatgcagttgctccagttgtgacttcgaacactccaaact |
10980976 |
T |
|
| Q |
219 |
ccttgggaaagagagcagctgagaatgtggttccagttgttgatgtcgctgaatttgatggatccacactaaaagagccaaaactggtccggtgtgaaga |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
10980975 |
ccttgggaaagagagcagctgagaatgtggtttcagttgttgatgtcgctgaatttgatggatccacaccaaaagagccaaaactggttcggtgtgaaga |
10980876 |
T |
|
| Q |
319 |
tcgaagctgaggagtgaagtcttttgcaaaattttcaactaccagtagtgttgctgatgtcca |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10980875 |
tcgaagctgaggagtgaagtcttttgcaaaattttcaactaccagtagtgtttctgatgtcca |
10980813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 65; Significance: 2e-28; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 99 - 191
Target Start/End: Complemental strand, 22617755 - 22617663
Alignment:
| Q |
99 |
agtctttggatgacattgatctggatgggtgtgaagcatcgagcacaaaagaaccaaaattggtgtctgcttcaaaggtagctgttgttgctc |
191 |
Q |
| |
|
|||| ||||||||||||||| ||| ||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
22617755 |
agtcgttggatgacattgatgtgggtggatgtgaagcatcgagcacaaaagaaccaaaaatggtgtctgcttcaaaggtagctgcagttgctc |
22617663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 25 - 105
Target Start/End: Complemental strand, 22617862 - 22617782
Alignment:
| Q |
25 |
aactattgaaggagttgattccgataacaaggacaaagttggtgtagccgattcagatgtaacactgattagcaagtcttt |
105 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||| |||||| | |||| | ||||||||||||| |||||||||||||||| |
|
|
| T |
22617862 |
aactattgaaggagttgattccaataataaggaagaagttgctctagctgcttcagatgtaacaatgattagcaagtcttt |
22617782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 233 - 266
Target Start/End: Complemental strand, 22617662 - 22617629
Alignment:
| Q |
233 |
gcagctgagaatgtggttccagttgttgatgtcg |
266 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
22617662 |
gcagctgagagtgtggttccagttgttgatgtcg |
22617629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University