View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8780_low_5 (Length: 237)
Name: NF8780_low_5
Description: NF8780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8780_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 119 - 224
Target Start/End: Complemental strand, 49580442 - 49580337
Alignment:
| Q |
119 |
aactaggaagagacataatagaaaaatcaacgttgattaatatgtcattcgtattgaaaaatgacatatacgttttttaatgacaaaatgtaagtatgtt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49580442 |
aactaggaagagacataatagaaaaatcaacgtcgattaatatgtcattaatattgaaaaatgacatatacgttttttaataacaaaatgtaagtatgtt |
49580343 |
T |
|
| Q |
219 |
atttgt |
224 |
Q |
| |
|
|||||| |
|
|
| T |
49580342 |
atttgt |
49580337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 49580566 - 49580481
Alignment:
| Q |
1 |
aaaaacacgcttcttcgtgataaagagtttcactatataacattgctctttacaaaattatctttaattaatattatgagatacat |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49580566 |
aaaaacacgcttcttcgtgataaagagtttcactatataacattgctctttacaaaattatctttaattaatattatgagatacat |
49580481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University