View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8781_high_8 (Length: 468)
Name: NF8781_high_8
Description: NF8781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8781_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 6e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 286 - 375
Target Start/End: Original strand, 31412855 - 31412944
Alignment:
| Q |
286 |
aggcttcaaactatgcaaacatttctctgttataggctttaaactatgcaatcgtagaagcaaaatgaaaatgggtttggagatggagaa |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31412855 |
aggcttcaaactatgcaaacatttctctgttataggcttcaaactatgcaatcgtagaagcaaaatgaaaatgggtttggagatggagaa |
31412944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 358 - 396
Target Start/End: Original strand, 31412953 - 31412991
Alignment:
| Q |
358 |
gggtttggagatggagaagaggatgaaggagttatgttt |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31412953 |
gggtttggagatggagaaagggatgaaggagttatgttt |
31412991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University