View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8781_low_24 (Length: 368)
Name: NF8781_low_24
Description: NF8781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8781_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 18 - 353
Target Start/End: Original strand, 41878743 - 41879078
Alignment:
| Q |
18 |
aaaaacagaactcaacacacacaacatagacacaatcaaacatgtggagaagaaactcatcaacaacggtgtccaacgtctggaccgccaccctgtcgac |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41878743 |
aaaaacagaactaaacacacacaacatagacacaatcaaacatgtggagaagaaactcatcaacaacggtgtccaacgtctggaccgccaccctgtcgac |
41878842 |
T |
|
| Q |
118 |
ggcataggcattggccgcggaccgccgaagtctggtcgtggtggtaagtttacttgggaaggtccggctgatatggttgataatatgcttgatccggcgc |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41878843 |
ggcataggcattggccgtggaccgccgaagtctggtcgtggtggtaagtttacttgggaaggtccggctgatatggttgataatatgcttgatccggcgc |
41878942 |
T |
|
| Q |
218 |
cggcggctatggatgagaatgatcctaattatgtagacgaggaagatggagaggatgctgctaaggagttgattgttggtgaggttgatgttgctaaggt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41878943 |
cggcggctatggatgagaatgatcctaattatgtagacgaggaagatggagaggatgctgctaaggagttgattgttggtgatgttgatgttgctaaggt |
41879042 |
T |
|
| Q |
318 |
tggtggggaaagagatggtgttgctagagttgatgt |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41879043 |
tggtggggaaagagatggtgttgctagagttgatgt |
41879078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University