View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8781_low_36 (Length: 264)
Name: NF8781_low_36
Description: NF8781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8781_low_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 3235353 - 3235160
Alignment:
| Q |
19 |
gatagcactattgttgtcaatatgtttgaagttttgctggtgtttaagtaagtaagtatgaaccaacaagcaacctttcctgtactctttggtcgatttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3235353 |
gatagcactattgttgtcaatatgtttgaagttttgctggtgtttaagtaagta----tgaaccaacaagcaacctttcctgtactctttggtcgatttg |
3235258 |
T |
 |
| Q |
119 |
gaaacaaagaaaatgtttgtatttggaagtatgtcacatacttactaacaagatggcaaaatgctaggatcagccacatgttagtagaagatggaaag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3235257 |
gaaacaaagaaaatgtttgtatttggaactatgtcacatatttactaacaagatggcaaaatgctaggatcagccacatgtaagtagaagatggaaag |
3235160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University