View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8781_low_40 (Length: 254)
Name: NF8781_low_40
Description: NF8781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8781_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 6508224 - 6508001
Alignment:
| Q |
15 |
cagatgggagaggggataatggtatagggtatgatcgttttattgttatatccttagggacaggatcaaacaaaagtgagcgcaagtacaatgctaagat |
114 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6508224 |
cagatgggagtggggacaatggtatagggtatgatcgttttattgttatatccttagggacaggatcaaacaaaagtgagcgcaagtacaatgctaagat |
6508125 |
T |
|
| Q |
115 |
ggtggctaaatggggtgctttaacttggttattcaacaatggatcaactccaatactagattgtttcaatgaggcaagcaatgatatggttgattatcat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6508124 |
ggtggctaaatggggtgctttaacttggttattcaacaatggatcaactccaatactagattgtttcaatgaggcaagcaatgatatggttgattatcat |
6508025 |
T |
|
| Q |
215 |
aacgctgtcctttttactgccctt |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6508024 |
aacgctgtcctttttactgccctt |
6508001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 32 - 238
Target Start/End: Complemental strand, 6502724 - 6502518
Alignment:
| Q |
32 |
aatggtatagggtatgatcgttttattgttatatccttagggacaggatcaaacaaaagtgagcgcaagtacaatgctaagatggtggctaaatggggtg |
131 |
Q |
| |
|
|||||||||||||||||||||||||| || || || ||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
6502724 |
aatggtatagggtatgatcgttttatagtgatctcaatagggacaggatcaaacaagagtgagcaaaagtacaatgctaagatggttgctaaatggggtg |
6502625 |
T |
|
| Q |
132 |
ctttaacttggttattcaacaatggatcaactccaatactagattgtttcaatgaggcaagcaatgatatggttgattatcataacgctgtcctttttac |
231 |
Q |
| |
|
|||| || |||||||||||| ||| ||||| ||||| |||||||||||||||| || |||| ||||||||||||||| |||||| | || |||||||| |
|
|
| T |
6502624 |
ctttgacatggttattcaactctggttcaacaccaattatagattgtttcaatgaagctagcactgatatggttgattaccataactcagttctttttac |
6502525 |
T |
|
| Q |
232 |
tgccctt |
238 |
Q |
| |
|
||||||| |
|
|
| T |
6502524 |
tgccctt |
6502518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University