View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8781_low_46 (Length: 247)
Name: NF8781_low_46
Description: NF8781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8781_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 27936670 - 27936442
Alignment:
| Q |
1 |
tccatggactctactggatcattcaaatctggcaaagtggaagtagcagtagaattattcgtatcttgtaaaggccgaaggttttctaagaacatccaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27936670 |
tccatggactctactggatcattcaaatctggcaaagtggaagtagcagtagaattattcgtatcttgtaaaggccgaaggttttctaagaacatccaat |
27936571 |
T |
 |
| Q |
101 |
ttgatcttgattcttttttaactgggagattttcaattatctctacgtcatctgaatcatctgatgtacgacttgatgtatctagagatgactcagcctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27936570 |
ttgatcttgattcttttttaactgggagattttcaattatctctacgtcatctgaatcatctgatgtacgacttgatgtatctagagatgactcagcctt |
27936471 |
T |
 |
| Q |
201 |
tacatgctctgcttgtagatgtgcattga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27936470 |
tacatgctctgcttgtagatgtgcattga |
27936442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 74 - 211
Target Start/End: Original strand, 27917254 - 27917389
Alignment:
| Q |
74 |
gccgaaggttttctaagaacatccaatttgatcttgattcttttttaactgggagattttcaattatctctacgtcatctgaatcatctgatgtacgact |
173 |
Q |
| |
|
||||||||||||||| | ||||||||| |||| ||||| ||||||||| || || ||||||||| | |||| || || ||||||||| ||||||| | |
|
|
| T |
27917254 |
gccgaaggttttctatggacatccaatgtgatattgatacttttttaattgtgaaattttcaat--tttctatgtgatttgaatcatccgatgtactgca |
27917351 |
T |
 |
| Q |
174 |
tgatgtatctagagatgactcagcctttacatgctctg |
211 |
Q |
| |
|
|||||||||||||||||| | || |||||||| ||||| |
|
|
| T |
27917352 |
tgatgtatctagagatgatttagtctttacattctctg |
27917389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University