View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8782_high_3 (Length: 430)
Name: NF8782_high_3
Description: NF8782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8782_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 9e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 19 - 250
Target Start/End: Complemental strand, 38990953 - 38990706
Alignment:
| Q |
19 |
ggaaggtcatgacttcaagtgttgttatgattagcgccactcttatgaagaaaaccaagttttatatggtggcgtagtcctttatcctccccctcccgat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38990953 |
ggaaggtcatgacttcaagtgttgttatgattagcgccactcttatgaagaaaaccaagttttatatggtggcgtagtcctttatcctccccctccctat |
38990854 |
T |
 |
| Q |
119 |
gtgaatttggtgcaatggaaccacttcactcatact---------------tataatt-actggataaaatcattaatgtttgaataaaatggtgctgat |
202 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||| | | |||||||||||||||| ||||||||| | ||||| |
|
|
| T |
38990853 |
gtgaatgtggtgcaatggaaccacttcactcatacttcttaggagttttcctataattgtttaaaaaaaatcattaatgtttaaataaaatgctcctgat |
38990754 |
T |
 |
| Q |
203 |
atttctcattgttatacttcttaaataaaaatatgttattacaagttt |
250 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38990753 |
atttctcgttgttatacttcttaaataaaaatatgttattacaagttt |
38990706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 370 - 409
Target Start/End: Complemental strand, 38990651 - 38990612
Alignment:
| Q |
370 |
tgaactgtgcttctctcaagatctcatgttcgattctctc |
409 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
38990651 |
tgaagtgtgtttctctcaagatctcatgttcgattctctc |
38990612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 416
Target Start/End: Complemental strand, 32206288 - 32206254
Alignment:
| Q |
382 |
ctctcaagatctcatgttcgattctctctgatgtc |
416 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
32206288 |
ctctcaagatctcatgttcgattccctctgatgtc |
32206254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 367 - 411
Target Start/End: Complemental strand, 19525563 - 19525519
Alignment:
| Q |
367 |
tcttgaactgtgcttctctcaagatctcatgttcgattctctctg |
411 |
Q |
| |
|
||||||| |||| |||||||||||||||| ||||||||| ||||| |
|
|
| T |
19525563 |
tcttgaagtgtgtttctctcaagatctcaggttcgattccctctg |
19525519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University