View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8782_high_5 (Length: 366)
Name: NF8782_high_5
Description: NF8782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8782_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 93 - 356
Target Start/End: Original strand, 44265570 - 44265818
Alignment:
| Q |
93 |
actacgaagtttttcgattatcttgaaggcctctttcctaagactcaagtttggtgatgcatctttctcacttggctcacatgctgatccatccaataat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44265570 |
actacgaagtttttcgattatcttgaaggcctctttcctaagactcaagtttggtggtgcatctttctcacttggctcacttgctgatccatccaataat |
44265669 |
T |
|
| Q |
193 |
actgatccatcacaaccctgcattttcannnnnnnaatccataaataaccaaatataataagtttggatttccaaagttagctaaacagattcatgctaa |
292 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44265670 |
actgatccatcacaaccctgcattttcatttttttaatccataaataaccaaatataataagtttggatttccaaagtta---------------gctaa |
44265754 |
T |
|
| Q |
293 |
tttaatcaccacatatgctaattacaagcattgtaatgcttaattagtattgtttatagtataa |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44265755 |
tttaatcaccacatatgctaattacaagcattgtaatgcttaattagtattgtttatagtataa |
44265818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 14974817 - 14974878
Alignment:
| Q |
18 |
gaaaacagcatcacgagcagcaacggcagtgatatcagcacaagagacgattcttccacact |
79 |
Q |
| |
|
||||||||| ||||||||||| | | |||||||||||||||| ||||| || |||||||||| |
|
|
| T |
14974817 |
gaaaacagcttcacgagcagctaagacagtgatatcagcacatgagactatccttccacact |
14974878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University