View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8782_high_7 (Length: 240)

Name: NF8782_high_7
Description: NF8782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8782_high_7
NF8782_high_7
[»] chr8 (2 HSPs)
chr8 (23-226)||(13572334-13572539)
chr8 (1-31)||(13572917-13572947)


Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 23 - 226
Target Start/End: Complemental strand, 13572539 - 13572334
Alignment:
23 ttgaatgaacataatagcttttatccctccttttgttggcaataattttttctatctattatttaacgaatgagtttccttgctcttctctatgtcagga 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13572539 ttgaatgaacataatagcttttatccctccttttgttggcaataattttttctatctattatttaacgaatgagtttccttgctcttctctatgtcagga 13572440  T
123 cgtatttcttttcttctcttgttgtgacatgcatga--------tagtttttccatactcccctaatttccacttgttggtaaggtctcaaacctttgtc 214  Q
    ||||||| |||| ||| |        |||| || ||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13572439 cgtattttttttgttcac------caacatccaagaaccatatttagtttttccatactcccctaatttccacttgttggtaaggtctcaaacctttgtc 13572346  T
215 gccacttgatgt 226  Q
    ||||||||||||    
13572345 gccacttgatgt 13572334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 13572947 - 13572917
Alignment:
1 tcgattttgtctttgtgttgcattgaatgaa 31  Q
    |||||||||||||||||||||||||||||||    
13572947 tcgattttgtctttgtgttgcattgaatgaa 13572917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University