View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8782_high_7 (Length: 240)
Name: NF8782_high_7
Description: NF8782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8782_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 23 - 226
Target Start/End: Complemental strand, 13572539 - 13572334
Alignment:
| Q |
23 |
ttgaatgaacataatagcttttatccctccttttgttggcaataattttttctatctattatttaacgaatgagtttccttgctcttctctatgtcagga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13572539 |
ttgaatgaacataatagcttttatccctccttttgttggcaataattttttctatctattatttaacgaatgagtttccttgctcttctctatgtcagga |
13572440 |
T |
 |
| Q |
123 |
cgtatttcttttcttctcttgttgtgacatgcatga--------tagtttttccatactcccctaatttccacttgttggtaaggtctcaaacctttgtc |
214 |
Q |
| |
|
||||||| |||| ||| | |||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13572439 |
cgtattttttttgttcac------caacatccaagaaccatatttagtttttccatactcccctaatttccacttgttggtaaggtctcaaacctttgtc |
13572346 |
T |
 |
| Q |
215 |
gccacttgatgt |
226 |
Q |
| |
|
|||||||||||| |
|
|
| T |
13572345 |
gccacttgatgt |
13572334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 13572947 - 13572917
Alignment:
| Q |
1 |
tcgattttgtctttgtgttgcattgaatgaa |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13572947 |
tcgattttgtctttgtgttgcattgaatgaa |
13572917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University