View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8782_high_9 (Length: 204)
Name: NF8782_high_9
Description: NF8782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8782_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 21 - 186
Target Start/End: Complemental strand, 40592378 - 40592213
Alignment:
| Q |
21 |
aggactgttggtcagagagtttcttagtaagttataggacagttgagctgagatagtagaagaaagaaggcatgttgcctaaaaatataaggacagttga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40592378 |
aggactgttggtcagagagtttcttagtaagttataggacagttgagctgagatagtagaagaaagaaggcatgttgcctaaaaataaaaggacagttga |
40592279 |
T |
 |
| Q |
121 |
gagggaatgatttctagtcattgactcattttagaagatataggggccaatggttaaggaggttgc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
40592278 |
gagggaatgatttctagtcattgactcattttagaagatacaggggccaatgtttaaggaggttgc |
40592213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University