View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8782_low_9 (Length: 291)
Name: NF8782_low_9
Description: NF8782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8782_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 4e-41; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 20 - 155
Target Start/End: Original strand, 2111040 - 2111189
Alignment:
| Q |
20 |
atagtatgctctaactggcatccttcctaaaagtgtttggttt----------attctttgttttggtaatttttagagaagagtaactact----tggt |
105 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2111040 |
atagtatgctctaactggtatccttcctaaaagtgtttagtttggtataaggtattctttgttttggtaatttttagagaagagtaactacttacttggt |
2111139 |
T |
|
| Q |
106 |
ttacacgcatgctctcttggaccaaagtattaatatgcatgagcagaatt |
155 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2111140 |
ttacacgcatggtctcttggaccaaagtattaatatgcatgagcagaatt |
2111189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 161 - 286
Target Start/End: Original strand, 2111239 - 2111370
Alignment:
| Q |
161 |
tttcatgcagaaacacaaaagtttccacttctagcattccatagcaacaaaccaatgagaccatag-----atcatagatacaatgg-ttctcaccaacc |
254 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
2111239 |
tttcatgcagatacacaaaagtttcctcttctagctttccatagcaacaaaccaatgagaccatagatcatatcatagatacaatggtttctcaccaacc |
2111338 |
T |
|
| Q |
255 |
tctcattactccccattttctctttctctgct |
286 |
Q |
| |
|
|||||| |||||||||||||||||||| |||| |
|
|
| T |
2111339 |
tctcataactccccattttctctttctttgct |
2111370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 72 - 169
Target Start/End: Original strand, 2129325 - 2129423
Alignment:
| Q |
72 |
tttggtaatttttagagaagagtaactacttggtttacac-gcatgctctcttggaccaaagtattaatatgcatgagcagaatttcccttttcatgca |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2129325 |
tttggtaatttttagagaagagtaactactttatctacaaagcatggtctcttggaccaaagtattaatatgcatgggcagaatttcccttttcatgca |
2129423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 161 - 243
Target Start/End: Original strand, 2129447 - 2129529
Alignment:
| Q |
161 |
tttcatgcagaaacacaaaagtttccacttctagcattccatagcaacaaaccaatgagaccatagatcatagatacaatggt |
243 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2129447 |
tttcatgcagaaacacaaaactttccacttctagcatttcatcacaacaaaccaatgaggccatagatcatagatacaatggt |
2129529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University