View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8783_high_10 (Length: 241)
Name: NF8783_high_10
Description: NF8783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8783_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 3 - 202
Target Start/End: Complemental strand, 6732761 - 6732562
Alignment:
| Q |
3 |
ttttgtttgttttgaaacttcaaatacttgaactctaggcacaaaacactattcttcattcaaccattgatcttcttcatattgatgtcaaagacatact |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
6732761 |
ttttgtttgttttgaaacttcaaatacttgaactctaggcacaaaacactattcttcattcaaccattgatcttcttcaaattgatgtcaaagatatact |
6732662 |
T |
|
| Q |
103 |
attccttgtcaaattccttctaaaactcaacaagtatttgttcacttcttcgtattttgtttttgttgaagtttaggattttttagttcttgatgaaata |
202 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6732661 |
attccttctcacattccttctaaaactcaacaagtaattgttcacttcttcgtattttgtttttgttgaagtttaggattttttagttgttgatgaaata |
6732562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University