View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8783_high_8 (Length: 255)
Name: NF8783_high_8
Description: NF8783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8783_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 26347581 - 26347823
Alignment:
| Q |
1 |
tcataagttgtgaccgatattgttcctattagggctgttccaggtcgtgttcccaccaagaaaatgaccaatacaactactgcgaaaaaggctaatcctt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26347581 |
tcataagttatgaccgatattgttcctattagggttgttccaggtcatgttcccaccaagaaaatgaccaatacaactactgcaaaaaaggctaatcctt |
26347680 |
T |
|
| Q |
101 |
cacatgtaagtgaaccctctcatcactctgtgtctgtttagttacttactagaaaacctaaaaatgttgtttcacctgttagtgtcaagaaacctcattc |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
26347681 |
cacatgtaagtgaaccctctcatcactttgtgtctgtttagttgcttactagaaaacataaaaatgttgtttcacctgttagtgttaagagacctcattc |
26347780 |
T |
|
| Q |
201 |
tatgactagtttgtaagttgatcccttgagtatgcctgatgtc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26347781 |
tatgactagtttgtaagttgatcccttgagtatgcctgatgtc |
26347823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University