View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8783_low_12 (Length: 255)
Name: NF8783_low_12
Description: NF8783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8783_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 44 - 241
Target Start/End: Original strand, 38330680 - 38330874
Alignment:
| Q |
44 |
ttagatcgcatgttttaagacacatgctaatttgtgcgcaaaatatgcaccannnnnnnnnnnnnngacaaatgataaatatgtaacatctttagtgatc |
143 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38330680 |
ttagatcgcatgttttaggacacatgctaatttgtgcgcaaaatatgtaccattttttttttt---gacaaatgataaatatgtaacatctttagtgatc |
38330776 |
T |
 |
| Q |
144 |
gatccgtcattagaaaaagtatgtttgatgatgcaagaatattatattaacggtttggatttgtttagttgcttattcaattatttgcttctattaac |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38330777 |
gatccgtcattagaaaaagtatgtttgatgatgcaagaatattatattaacggtttggatttgtttagttgcttattcaattatttgcttatattaac |
38330874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University