View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8783_low_14 (Length: 246)
Name: NF8783_low_14
Description: NF8783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8783_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 30 - 168
Target Start/End: Original strand, 6732845 - 6732983
Alignment:
| Q |
30 |
tgataactttcgatgctattaaatcgtaacttctgatcgatataaaaggggcaatttaaaattttaggaacatgtgaaaaattgagagggcctaaagagc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6732845 |
tgataactttcgatgctattaaatcgtaactcctgatcgatataaaaagggcaatttaaaattttaggaacctgtgaaaaattgagagggcctaaagagc |
6732944 |
T |
 |
| Q |
130 |
aattctcattcatgatgatatgcatatattgacttagac |
168 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
6732945 |
aattctcattcatgatgatatgcatgtactgacttagac |
6732983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University