View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8783_low_9 (Length: 314)
Name: NF8783_low_9
Description: NF8783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8783_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 104 - 302
Target Start/End: Original strand, 38579959 - 38580156
Alignment:
| Q |
104 |
ttggatcaagtagttcggtgactagaattcatctttttaagttgaataaatagggtgtctagagttcgaacttcagtttttatatataacaatacatgat |
203 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||| ||||||| || |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38579959 |
ttgggtcaagtagttcggtgactaaaattcatctttttaagatgaataagtaaggtgtctagagtccgaacttcagtttttatatataacaatacatgat |
38580058 |
T |
 |
| Q |
204 |
gtctctgtcaactgaactataccagtaagaatactcgataataagagcttattcttttaaatacccgatatcatatattcttttaaatacatgatgtcc |
302 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| | ||||| | |||||||||||||||||||||||||| |
|
|
| T |
38580059 |
gtctctgtcaactgaactatactagtaaggatactcgataataagagcttattcttttaaat-ctcgataccctatattcttttaaatacatgatgtcc |
38580156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 38579865 - 38579901
Alignment:
| Q |
1 |
tggtccaaaaa-tggtccaaaagtgcaattttttctt |
36 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38579865 |
tggtccaaaaagtggtccaaaagtgcaattttttctt |
38579901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 130 - 178
Target Start/End: Complemental strand, 10304501 - 10304453
Alignment:
| Q |
130 |
attcatctttttaagttgaataaatagggtgtctagagttcgaacttca |
178 |
Q |
| |
|
||||| ||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
10304501 |
attcaccttttaaaggtgaataaataaggtgtctagagttcgaacttca |
10304453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 129 - 162
Target Start/End: Original strand, 16119878 - 16119911
Alignment:
| Q |
129 |
aattcatctttttaagttgaataaatagggtgtc |
162 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
16119878 |
aattcatctttttaaggtgaataaatagggtgtc |
16119911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University