View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8784_high_1 (Length: 450)
Name: NF8784_high_1
Description: NF8784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8784_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 237
Target Start/End: Original strand, 27791681 - 27791900
Alignment:
| Q |
16 |
caaaaaacgtgcaaatccaaagcatgaaaaagcttttgacatgatcagttggacaagtgcagaatcagcacctgaaatgtggcaactcacctaaaagaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27791681 |
caaaaaacgtgcaaatccaaagcatgaaaaagcttttgacatgatcagttggacaagtgcagaatcagcacctgaaatgtggcaactcacctaaaagaaa |
27791780 |
T |
 |
| Q |
116 |
ccaaacttgttttagaaccccacacacattgttaattacacatcagattcgctgcagtcacaaatttgctgcattcatgcattcagcacataagcccgat |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
27791781 |
ccaaacttgttttagaaccc--cacacattgttaattacacatcagattcgctgcagtcacaaatttgccacattcatgcattcagcacataagcctgat |
27791878 |
T |
 |
| Q |
216 |
ttagatccaaaaattgaggatg |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27791879 |
ctagatccaaaaattgaggatg |
27791900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 268 - 440
Target Start/End: Original strand, 27791876 - 27792048
Alignment:
| Q |
268 |
gatctagatccaaaaattgaggatgtgccatatgcatgaatgcggcaaatttgtgactgcagggaatcctgggcatgacagtaaagttaagctttacatc |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27791876 |
gatctagatccaaaaattgaggatgtgccatatgcatgaatacggcaaatttgtgactgcagggaatcctgggcatgacagtaaagttaagctttacatc |
27791975 |
T |
 |
| Q |
368 |
tgtgacagaagagttccactagatgtgaaagcaaggctaaattagttagtacatccttgtagtttcatctcac |
440 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27791976 |
tggggcagaagagttccactagatgtgaaagcaaggataaattagttagtacatccttgtagtttcatttcac |
27792048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 335
Target Start/End: Complemental strand, 27791860 - 27791824
Alignment:
| Q |
299 |
atgcatgaatgcggcaaatttgtgactgcagggaatc |
335 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
27791860 |
atgcatgaatgtggcaaatttgtgactgcagcgaatc |
27791824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University