View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8784_high_7 (Length: 351)
Name: NF8784_high_7
Description: NF8784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8784_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 173 - 342
Target Start/End: Original strand, 5283450 - 5283618
Alignment:
| Q |
173 |
tgttacacatgggcacgaagaaagcaacaaattttccaagcggcacggcggcgtgaaaagtctctacgtctgaaatcacgtccgccattgccgcttaaca |
272 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5283450 |
tgttacacatgggcacga-gaaagcaacaaattttccaagcggcacggtggcgtgaaaagtctctacgtctgaaatcacgtccgccattgccgcttaaca |
5283548 |
T |
 |
| Q |
273 |
ctcaatggctccttctttatcgcgcctcttaacttcacctccaaaccctatcaacttcaccacttcatct |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5283549 |
ctcaatggctccttctttatcgcgcctcttaacttcacttccaaaccctatcaacttcaccacttcatct |
5283618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University