View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8784_low_16 (Length: 251)
Name: NF8784_low_16
Description: NF8784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8784_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 35473764 - 35473532
Alignment:
| Q |
1 |
attaacaacattattattaataatattgttgttgtgatcaaataatgggtttggaggaattgaaagaaattggttaatattattatcaatgaagcaatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35473764 |
attaacaacattattattaataatattgttgttgtgatcaaataatggatttggaggaattgaaagaagttggttaatattattatcaatgaagcaatca |
35473665 |
T |
 |
| Q |
101 |
ttgataaggtcagaaccaaagttagatattgcatcttcatgctcacctcgaattaaatcgataaattgatcaaagtttggatcatcgatgaagtcatgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
35473664 |
ttgataaggtcagaaccaaagttagatattgcatcttcatgctcacctcgaattaaatcgataaattgatcaaagtttggatcgtcaatgaagtcatgca |
35473565 |
T |
 |
| Q |
201 |
gctcaaagttattggtgttgtctagtgatgagt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35473564 |
gctcaaagttattggtgttgtctagtgatgagt |
35473532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University