View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8784_low_20 (Length: 242)
Name: NF8784_low_20
Description: NF8784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8784_low_20 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 12615394 - 12615171
Alignment:
| Q |
19 |
ttacatataactgttaatcctatgttccatgaaagaaccaaacatatggataaactaccattttgttcatggcaaagttccagaaggcgccatcaaattg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12615394 |
ttacatataactgttaatcctatgttccatgaaagaaccaaacatatggataaactaccattttgttcatggcaaagttccagaaggcaccatcaaattg |
12615295 |
T |
|
| Q |
119 |
caaccaatttcaagtagtgaacaagcaaccaatttcttccccaagcgagacatggtagatatgtataccaagctctagctggggggactgtaaaaacata |
218 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12615294 |
caaccaatttcaagtagtgaacaagcagctaatttcttcaccaagcgagacatggtagatatgtataccaagctctagctggggggactgtaaaaacata |
12615195 |
T |
|
| Q |
219 |
atgaagatgtcgttacttgagatc |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
12615194 |
atgaagatgtcgttacttgagatc |
12615171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 157
Target Start/End: Original strand, 12581864 - 12581943
Alignment:
| Q |
77 |
cattttgttcatggcaaagttccagaaggcgccatcaaattgcaaccaatttcaagtagtgaacaagcaaccaatttcttc |
157 |
Q |
| |
|
|||||||||| || ||||||| ||||||| |||||| ||||| | ||||| ||||||||||||||||||| |||||||| |
|
|
| T |
12581864 |
cattttgttcgtgagaaagttcaagaaggcaccatcagattgctatcaatt-caagtagtgaacaagcaactgatttcttc |
12581943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 242
Target Start/End: Original strand, 12582029 - 12582065
Alignment:
| Q |
206 |
ctgtaaaaacataatgaagatgtcgttacttgagatc |
242 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
12582029 |
ctgttaaaacataatgaagatgtagttacttgagatc |
12582065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University