View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8784_low_23 (Length: 238)
Name: NF8784_low_23
Description: NF8784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8784_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 45129296 - 45129519
Alignment:
| Q |
1 |
attttattaattagtaatgattgatgtaacatgtttcaaaaagcagtaaaggtgacaagtttacctgcataactttcaccagttagaaacaaatctctgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45129296 |
attttattaattagtaatgattgatgtaacatgtttcaaaaagcagtaaaggtgacaagtttacctgcataactttcaccagttagaaacaaatctctgt |
45129395 |
T |
|
| Q |
101 |
ttctatattgaggaaacttgttgaaccaacgttccaagaatacaagattgtcccttgcttaacaattcaaaaaagcaccgtttcagattacaaaatatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45129396 |
ttctatattgaggaaacttgttgaaccaacgttccaagaatacaagattgtcccttgcttaacaattcaaaaaagcaccgtttcagattacaaaatatgt |
45129495 |
T |
|
| Q |
201 |
acagtacaataaaaccatcatcat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45129496 |
acagtacaataaaaccatcatcat |
45129519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 61 - 155
Target Start/End: Original strand, 40281445 - 40281539
Alignment:
| Q |
61 |
ttacctgcataactttcaccagttagaaacaaatctctgtttctatattgaggaaacttgttgaaccaacgttccaagaatacaagattgtccct |
155 |
Q |
| |
|
||||||||||||||||| || || | |||||||||| ||| | | ||||| || ||||||||||||||| || |||||| ||||| |||||||| |
|
|
| T |
40281445 |
ttacctgcataactttctcctgtcaaaaacaaatctgtgtgtttgtattgggggaacttgttgaaccaatgtagcaagaacacaaggttgtccct |
40281539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University