View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8786_high_3 (Length: 371)
Name: NF8786_high_3
Description: NF8786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8786_high_3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 3e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 234 - 371
Target Start/End: Original strand, 8184129 - 8184266
Alignment:
| Q |
234 |
gttcgcacatgattctttgttgattggaatcacacagcggaagagaacatgatgcaatgcaggatgcctcagcttcagaactcctaatattgtctttcat |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8184129 |
gttcgcacatgattctttgttgattggaatcacacagcggaagagaacatgatgcaatgcaagatgcctcagcttcagaactccaaatattgtctttcat |
8184228 |
T |
|
| Q |
334 |
cattggtccttccttatcttatgaactcctaatattga |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8184229 |
cattggtccttccttatcttatgaactcctaatattga |
8184266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University