View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8786_low_1 (Length: 461)
Name: NF8786_low_1
Description: NF8786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8786_low_1 |
 |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 35 - 458
Target Start/End: Complemental strand, 49825515 - 49825101
Alignment:
| Q |
35 |
agatttgattgaggcaaacagtcaggtaaattatgatcactttggttatatcnnnnnnnnatattgtgatacgatcgtatttttatgcatgttggtaatt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
49825515 |
agatttgattgaggcaaacagtcaggtaaattatgatcactttggttatagcttttt----tattgtgatatgattgtatttttatgcatgttattaatt |
49825420 |
T |
 |
| Q |
135 |
tggagtgcgtttcatttgatcagggtaaaccctcaagcgagcgagtatccaaatgaatttgatattgttgttggaaaacaaatgctatttaaggttggaa |
234 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||| ||||| || |||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
49825419 |
tggagtgcgttttatttgatcagggtaaaccctcaagcgag----tatcccaatgagttggatatttttgttggaaaacaaatgctatttaaggttgaaa |
49825324 |
T |
 |
| Q |
235 |
ttacggatgggaacttaatgcataattggcgcaactatgcggtcaaaaggacatctgatgaatcaatttgtgactcttcacaacattacaatgacgaata |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49825323 |
ttacggatgggaacttaatgcataattggcgcaactatgctgtcaaaaggacatctgatgaatcaatttgtgactcttcacaacattacaatggcgaata |
49825224 |
T |
 |
| Q |
335 |
tcctgctgatctggatttgttcatagacnnnnnnnntgttgtttaaagttgagataactgatggcaacttgaagcatggatggcgtaactaagctgtgaa |
434 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49825223 |
tcctgctgatctggatttgttcatagac-aaaaaaatgttgtttaaagtcgagataactgatggcaacttgaagcatggatggcgtaactaagttgtgaa |
49825125 |
T |
 |
| Q |
435 |
gcgggtgtatgatgatgtccatct |
458 |
Q |
| |
|
|||||||| |||||||||| |||| |
|
|
| T |
49825124 |
gcgggtgtctgatgatgtcgatct |
49825101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 202 - 286
Target Start/End: Original strand, 232573 - 232658
Alignment:
| Q |
202 |
ttgttggaaaacaaatgctatttaaggttggaattacggatgggaacttaatgcata-attggcgcaactatgcggtcaaaaggac |
286 |
Q |
| |
|
|||||||||| ||||| | |||||||||| |||||||||||||||||| ||||| | ||||||||| ||| | ||||||||||| |
|
|
| T |
232573 |
ttgttggaaagaaaatgttgtttaaggttgaaattacggatgggaacttgatgcagagcttggcgcaattattctgtcaaaaggac |
232658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 202 - 286
Target Start/End: Complemental strand, 14584802 - 14584717
Alignment:
| Q |
202 |
ttgttggaaaacaaatgctatttaaggttggaattacggatgggaacttaatgcata-attggcgcaactatgcggtcaaaaggac |
286 |
Q |
| |
|
|||||||||| ||||| | |||||||||| |||||||||||||||||| ||||| | ||||||||| ||| | ||||||||||| |
|
|
| T |
14584802 |
ttgttggaaagaaaatgttgtttaaggttgaaattacggatgggaacttgatgcagagcttggcgcaattattctgtcaaaaggac |
14584717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University