View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8788_high_12 (Length: 219)
Name: NF8788_high_12
Description: NF8788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8788_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 14225364 - 14225148
Alignment:
| Q |
1 |
ggaatgtcgtttttatcctatccttcatcttttctatctcatcgttcaccttttccatctcgatgtacaccttgttctcgttgcgctgaacaatcctatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14225364 |
ggaatgtcgtttttatcctatccttcatcttttctatctcatcgttcaccttttccatctcgatgtacaccttgttctcgttgcgctgaacaatcctatg |
14225265 |
T |
 |
| Q |
101 |
aaaaatcctatcttcaagttcttgcatccagcttggagcttgaccagacaaccctgcatcctgagcttcaccctcttgcattggccaattttcagaaact |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14225264 |
aaaaatcctatcttcaagtccttgcatccagcttggagcttgaccagacaaccctgcatcctgagcttcaccctcttgcattggccaattttcagaaact |
14225165 |
T |
 |
| Q |
201 |
tcagcttgaacacgaaa |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
14225164 |
tcagcttgaacacgaaa |
14225148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University