View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8788_high_7 (Length: 271)
Name: NF8788_high_7
Description: NF8788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8788_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 65 - 254
Target Start/End: Complemental strand, 5821570 - 5821377
Alignment:
| Q |
65 |
cgttacggtgatgagttaatgcatcattatactttgaatgtggatgaaactttgtgttgatggaagagt----gaggtttcatttttatttgaagtaact |
160 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
5821570 |
cgttatggtaatgagttaatgcatcattatactttgaatgtggatgaaactttgtgttggtggaagagtaagtgaggttttatttttatttgaagtaact |
5821471 |
T |
|
| Q |
161 |
cgctactaacattatgttaatcctacgtcttccgggccagctaacttgcaacattcggacggtactgaaggtgggtttagtcgggtggattggt |
254 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||| ||||| |||||||| | ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5821470 |
tgctactagcattatgttaatcctacgtctgccgggccagataactcgcaacatttgaacggtactgaacgtgggtttagtcgggtggattggt |
5821377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University