View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8788_low_11 (Length: 251)
Name: NF8788_low_11
Description: NF8788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8788_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 123 - 234
Target Start/End: Complemental strand, 51196008 - 51195897
Alignment:
| Q |
123 |
tgagtcatccatccttccattcatcttggtatatatgctcttcctcgaacaaaggttttctcattcacatatatatgcaattgccgtaacgctcttgtcg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51196008 |
tgagtcatccatccttccattcatcttggtatatatgctcttcctcgaacaaaggttttctcattcacatatatatgcaattgccgtaacgctcttgtcg |
51195909 |
T |
 |
| Q |
223 |
atgcatctaaat |
234 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51195908 |
atgcatctaaat |
51195897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 57 - 114
Target Start/End: Complemental strand, 51196090 - 51196033
Alignment:
| Q |
57 |
tattgttcaacactcatttttgcatctaatatgagacttctgtctcacatttgctaca |
114 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
51196090 |
tattgttcaacattcatttttgcatttaatataagacttttgtctcacatttgctaca |
51196033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University