View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8788_low_15 (Length: 201)
Name: NF8788_low_15
Description: NF8788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8788_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 2e-38; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 17 - 117
Target Start/End: Complemental strand, 13712951 - 13712852
Alignment:
| Q |
17 |
ttcgtgttgccactatgtttcattgttctattaatcttcctttgctcaaaaccctttatctatcttcagttcaatctgaagatatgattagatttcatga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
13712951 |
ttcgtgttgccactatgtttcattgttctattaatcttcctttgctcaaaacccgttatctatcttcagttcaatttgaagatatga-aagatttcatga |
13712853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 126 - 185
Target Start/End: Complemental strand, 13712665 - 13712606
Alignment:
| Q |
126 |
taatcatgcatcctcctttgtcagcatcggtaatatattattacattgtatcatctttct |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13712665 |
taatcatgcatcctcctttgtcagcatcggtaatatattattacattgtatcatctttct |
13712606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University