View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8789_low_14 (Length: 227)
Name: NF8789_low_14
Description: NF8789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8789_low_14 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 3 - 227
Target Start/End: Original strand, 9884064 - 9884287
Alignment:
| Q |
3 |
tttcggcctattttaacttttgaagacaaattatggttggctcatacttgtatgacaatgaaagagctactataaaggatgattaaggtttacacttaga |
102 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9884064 |
tttcggcctattttaacttt-gaagacaaattatggttggctcatacttgtatgacaatgaaagagctactataaaggatgattaaggtttacacttaga |
9884162 |
T |
|
| Q |
103 |
tgatgttgtaaatcaatcatgttgttctcacgtactggcactaatctcagatttgtattttgtaatatcctctttgttgagagttataatcttaggaaat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9884163 |
tgatgttgtaaatcaatcatgttgttctcacgtacaggcactaatcccagatttgtattttgtaatatcctctttgttgagagttataatcttaggaaat |
9884262 |
T |
|
| Q |
203 |
aacattataccacgaggtggtaaca |
227 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9884263 |
aacattataccacgaggtggtaaca |
9884287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 132
Target Start/End: Original strand, 9884300 - 9884333
Alignment:
| Q |
99 |
tagatgatgttgtaaatcaatcatgttgttctca |
132 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
9884300 |
tagatgatgttgtaaatcaatcaagttgttctca |
9884333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University