View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8789_low_8 (Length: 285)
Name: NF8789_low_8
Description: NF8789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8789_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 40 - 268
Target Start/End: Original strand, 4880871 - 4881099
Alignment:
| Q |
40 |
gtgtctcagtgtcgggcacgcgttgtatactacaacgatatgacatcaaaaatagaactacactgtattatgtaannnnnnnaaattatcagcaatgtca |
139 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
4880871 |
gtgtttcagtgtcgggcacgcgttatatactacaacgatacgacatcaaaaatataactacactgtattatgtaatttttttaaattattagcaatgtcg |
4880970 |
T |
 |
| Q |
140 |
gcgtgttagtatccatgtgatttagtgtttcatagatttaatttccttaccacacatgtatgaacatcatcacatccacacaatagctctccattgagag |
239 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4880971 |
gcgtgttagtatccgtgtgtttcagtgtttcatagatttaatttccttaccacacatgtatgaacatcatcacatccacacaatagctctccattgagag |
4881070 |
T |
 |
| Q |
240 |
tgtccacagcttgaaatgacccacctcct |
268 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
4881071 |
tgtccacagcttgaaatgaccctcctcct |
4881099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University