View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8790_low_4 (Length: 378)
Name: NF8790_low_4
Description: NF8790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8790_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 153 - 375
Target Start/End: Original strand, 33927948 - 33928179
Alignment:
| Q |
153 |
ctgaacacttttcaggcatagaatcacaagttgacttgtcccaagcagcaccattgttaagattctcaaatgaaagaatagaatcaaactcttgatcatg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33927948 |
ctgaacacttttcaggcatagaatcacaagttgacttgtcccaagcagcaccattgttaagattctcaaatgaaagaatagaatcaaactcttgatcatg |
33928047 |
T |
|
| Q |
253 |
tgaaactccaccatcttgtaataattcacctttgctggtaattttg---------tgatgatgatggatttcaaggtttaaatcagctggaactgaagca |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33928048 |
tgaaactccaccatcttgtaataattcacctttgctggtaattttgtgatgatgatgatgatgatggatttcaaggtttaaatcagctggaactgaagca |
33928147 |
T |
|
| Q |
344 |
gacttcactaataatttcccattattttcaaa |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33928148 |
gacttcactaataatttcccattattttcaaa |
33928179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 35786792 - 35786868
Alignment:
| Q |
1 |
atgaaaattattgtaaacaccaaatgggacaaaattattgtaaactgagaaaccagaaggacgaggaagtaaaggac |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786792 |
atgaaaattattgtaaacaccaaatgggacaaaattattgtaaactgagaaaccagaaggacgaggaagtaaaggac |
35786868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University