View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8791_high_4 (Length: 313)
Name: NF8791_high_4
Description: NF8791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8791_high_4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 11 - 313
Target Start/End: Complemental strand, 2144571 - 2144270
Alignment:
| Q |
11 |
gtgagaagaacctagtttgtaggtgatgggtgtgagtacattgtaagttttatttgtgctttgaggtgtgacttggccgtagtgaatgaaaagtttatca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2144571 |
gtgagaagaacctagtttgtaggtgatgggtgtgagtacattgtaagctttatttgtgctttgaggtgtgacttggccgtagtgaatgaaaagtttatca |
2144472 |
T |
|
| Q |
111 |
ctgcactttttctttactagctgaaacattatatcctcagacgcttgaactgttttctttcttgtctggtcttttttaaggtgataaaaccgatagttgc |
210 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2144471 |
ctgcacttttt-tttactagctgaaacataatatcctcagacgcttgaactgttttctttcttgtctggtcttttttaaggtgataaaaccgatagttgc |
2144373 |
T |
|
| Q |
211 |
tcgataggtcccttggatttctcatagacccctcaaccaatctggtcataacttccgatcgggnnnnnnnagaaaacgtgagcaatttgaggggcctatt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2144372 |
tcgataggtcccttggatttctcatagacccctcaaccaatctggtcataacttccgatcgggtttttttagaaaacgtgagcaatttgaggggcctatt |
2144273 |
T |
|
| Q |
311 |
att |
313 |
Q |
| |
|
||| |
|
|
| T |
2144272 |
att |
2144270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University