View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8791_high_5 (Length: 253)

Name: NF8791_high_5
Description: NF8791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8791_high_5
NF8791_high_5
[»] chr5 (1 HSPs)
chr5 (10-237)||(40942295-40942522)


Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 237
Target Start/End: Complemental strand, 40942522 - 40942295
Alignment:
10 taaactgcactaagaggatcaaagtatgctatcctttgctgtggttttttgggtgtcaaggttgcaagactattttaaagggaggtgatgggtgatgaat 109  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
40942522 taaactgcactaagaggatcaaagtatgatatcctttgctgtggttttttgggtgtcaagattgcaagactattttaaagggaggtgatgggtgatgaat 40942423  T
110 ttcctaaacgataaaagtatagctacaatgtgaaaaaggtagaagtatgaataaaaatgttatattgaatatgaacatgacagatgcccataagttttgg 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40942422 ttcctaaacgataaaagtatagctacaatgtgaaaaaggtagaagtatgaataaaaatgttatattgaatatgaacatgacagatgcccataagttttgg 40942323  T
210 aatgttcatgcaacatagaccaaaatag 237  Q
    ||||||||||||||||||||||||||||    
40942322 aatgttcatgcaacatagaccaaaatag 40942295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University