View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8791_high_7 (Length: 243)

Name: NF8791_high_7
Description: NF8791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8791_high_7
NF8791_high_7
[»] chr4 (1 HSPs)
chr4 (1-89)||(8171634-8171722)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 8171722 - 8171634
Alignment:
1 tgctgcaatagctgatatgaattcgactacatcgggttctttgtcccttttggcctgcaaaatgaaattaagaaagttaagactggaaa 89  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
8171722 tgctgcaatagctgatatgaattcggctacatcgggttctttgtcccttttggcctgcaaaatgaaattaagaaagataagactggaaa 8171634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University