View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8791_low_11 (Length: 305)
Name: NF8791_low_11
Description: NF8791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8791_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 24 - 293
Target Start/End: Original strand, 10219615 - 10219884
Alignment:
| Q |
24 |
tcatcaactcctctaacccttcccaatgtgtcgcctacgcgcaggaacagaacgattgttttcgttcagagtatgattccattgttaaagattgtgatca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10219615 |
tcatcaactcctctaacccttcccaatgtgtcgcctacgcgcagcaacagaacgattgttttcgttcagagtatgattccattgttaaagattgtgatca |
10219714 |
T |
|
| Q |
124 |
acatattgcttgggctactgaagcatttggtttagagcctgaagctgttaatctttggattgggaacaaacattcatctacttggtttcataaggatcat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10219715 |
acatattgcttgggctactgaagcatttggtttagagcctgaagctgttaatctttggattggaaacaaacattcatctacttggtttcataaggatcat |
10219814 |
T |
|
| Q |
224 |
tatgagaatctttatgctgttgttactggtcaaaaacactttcttttgtttcctcctactgatgtccatc |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10219815 |
tatgagaatctttatgctgttgttactggtcaaaaacactttcttttgtttcctcctactgatgttcatc |
10219884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University