View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8791_low_12 (Length: 291)
Name: NF8791_low_12
Description: NF8791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8791_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 15 - 278
Target Start/End: Original strand, 33015775 - 33016032
Alignment:
| Q |
15 |
cttagtacaataaagagttnnnnnnnttaacttggaattaattgattgtagatagtgactttatggaaacaaaaattggtggtttaaacagtgatttgga |
114 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33015775 |
cttagtacaataaagagttaaaaaaattaacttgg----aattgattgtagatagtgactttatggaaacaaaaattggtggtttaaacagtgatttgga |
33015870 |
T |
 |
| Q |
115 |
cttatattttaatttttagctacaagcctacaaccaaccaag-nnnnnnnnggcttttgaggcatataaagatagaggnnnnnnnnntctggatttgagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
33015871 |
cttatattttaatttttagctacaagcctacaaccaaccaagtttttttttggcttttgaggcatataaagataaagg---aaaaaatctggatttgagt |
33015967 |
T |
 |
| Q |
214 |
tgtataaagtaaaagggnnnnnnngttgcaacaaactttcacttgagtcacattaaaccatagaa |
278 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33015968 |
tgtataaagtaaaagggaaaaaaagttgcaacaaactttcacttgagtcacattaaaccatagaa |
33016032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University